• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Anampses geographicus

Sample ID: VIS 181
Search the Seafood List: Search Anampses geographicus on the FDA Seafood List
Acceptable Market Name(s): NA
Common Name(s): Scribbled Wrasse
Date Posted: 08/2021
Voucher Location: NMNH
Voucher Number: USNM 435528
Metadata: Source: Smithsonian Institution NMNH, market survey, Philippines
COI 5' Barcode (655bp):
>VIS-181|Anampses_geographicus
CCTTTATTTAGTATTCGGCGCCTGAGCCGGAATGGTAGGCACAGCCCTAAGTCTACTTATTCGAGCTGAACTGAGCCAGCCCGGCGCCCTCCTTGGGGACGACCAGATCTACAATGTAATCGTTACAGCCCATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGCGGGTTCGGAAACTGACTTATCCCCTTAATAATTGGAGCGCCTGATATGGCCTTCCCCCGAATAAACAACATGAGCTTTTGACTTCTACCTCCATCTTTCTTACTCCTTCTCGCTTCCTCTGGCGTAGAGGCTGGAGCTGGGACTGGTTGAACAGTATACCCGCCTTTAGCGGGTAACCTCGCCCACGCAGGTGCATCCGTAGATCTAACGATCTTCTCCCTACATTTAGCCGGCATCTCATCGATTCTAGGCGCAATTAATTTTATTACAACTATCATTAATATGAAACCCCCTGCTATTTCCCAATACCAAACCCCTCTTTTCGTCTGAGCAGTACTAATTACAGCAGTTCTCCTACTCCTCTCTTTACCTGTCCTTGCAGCTGGAATTACTATGCTTTTAACAGATCGAAACCTTAATACTACTTTCTTTGACCCTGCAGGAGGCGGAGATCCTATCCTTTACCAACATCTCTTT
Image:
Flickr: View Anampses geographicus, VIS 181 on Flickr


Please be advised that this website contains links to non-federal websites. You may read the full disclaimer for accessing these websites here.
-
-