• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Hippoglossoides platessoides

Sample ID: FDA 120
Search the Seafood List: Search Hippoglossoides platessoides on the FDA Seafood List
Acceptable Market Name(s): Plaice or Flounder
Common Name(s): American Plaice
Date Posted: 11/2011
Date Modified: 10/2021
Voucher Location: NMNH
Voucher Number: USNM 395466
Metadata: Source: NOAA, Gulf of Maine, Cruise ID 200703, Station 331
COI 5' Barcode (655bp):
>FDA_120|Hippoglossoides_platessoides
TCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGGACAGGCCTAAGTCTGCTCATTCGAGCAGAACTCAGCCAACCCGGGGCTCTCCTGGGAGACGATCAAATTTATAACGTGATCGTTACCGCACACGCCTTTGTAATAATCTTCTTTATAGTAATACCAATTATGATCGGAGGGTTCGGAAACTGACTTATCCCGCTAATGATCGGAGCCCCTGATATGGCCTTCCCTCGGATAAATAACATGAGCTTCTGACTTCTACCCCCATCATTTCTTCTCCTCTTAGCCTCTTCAGGTGTAGAAGCCGGGGCTGGTACTGGATGAACCGTATATCCTCCCCTTGCTGGAAATCTGGCACACGCCGGAGCGTCCGTAGATCTCACAATTTTCTCTCTTCACCTTGCCGGAATTTCATCAATCCTGGGAGCAATCAACTTTATTACCACCATCATCAACATGAAACCTACGGCGGTCACTATATACCAAATCCCACTATTCGTGTGAGCCGTACTAATTACGGCAGTCCTTCTCCTCCTTTCCCTTCCGGTCTTAGCCGCTGGCATCACAATGCTACTAACAGACCGCAACCTAAACACAACTTTCTTTGACCCTGCCGGAGGGGGTGATCCCATCCTCTACCAGCATCTATTC
Image:
Flickr: View Hippoglossoides platessoides, FDA 120 on Flickr
Photographer: J. Deeds


Please be advised that this website contains links to non-federal websites. You may read the full disclaimer for accessing these websites here.
-
-