• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Lutjanus griseus

Sample ID: FDA 004 2
Search the Seafood List: Search Lutjanus griseus on the FDA Seafood List
Acceptable Market Name(s): Snapper
Common Name(s): Gray Snapper
Date Posted: 11/2011
Date Modified: 10/2021
Voucher Location: NMNH
Voucher Number: USNM 395518
Metadata: Source: Florida Fish and Wildlife Conservation Commission, Collected in Titusville, FL, 2002
COI 5' Barcode (655bp):
>FDA_004-2|Lutjanus_griseus
CCTTTATCTTGTATTCGGTGCTTGAGCCGGAATAGTAGGCACGGCCTTAAGCCTGCTCATTCGAGCAGAACTAAGCCAACCAGGAGCCCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGATTTGGAAACTGACTGATCCCATTAATGATCGGAGCCCCCGACATGGCATTCCCCCGAATAAATAACATGAGCTTTTGACTCCTTCCCCCATCCTTCCTACTACTACTCGCCTCCTCTGGAGTAGAAGCCGGTGCCGGAACAGGATGAACAGTTTACCCTCCCTTAGCAGGAAATCTAGCACACGCAGGAGCATCTGTCGACCTAACCATTTTCTCCCTCCACTTAGCAGGTGTTTCTTCAATTCTAGGGGCCATCAACTTTATTACAACAATCATCAATATGAAACCTCCTGCCATCTCACAATATCAAACACCACTATTCGTTTGAGCCGTCCTAATCACTGCTGTGCTACTTCTCCTGTCCCTTCCTGTACTAGCTGCCGGAATTACAATGCTCCTTACAGACCGAAATCTAAACACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTTTATCAACACCTATTC

*Definitions

  • CAS Reg. No. (or other ID): Chemical Abstract Service (CAS) Registry Number© for the substance or a numerical code (other ID) assigned by CFSAN to those substances that do not have a CAS Registry Number (977nnn-nn-n or 809777nnn-nn-n series).
  • Substance: A name of the additive or impurity as recognized by CFSAN.
  • Calculation/Update Date: The date on which the CEDI was calculated or re-evaluated.
  • CDC: Cumulative Dietary Concentration (CDC, parts-per-billion, ppb)
  • CEDI: Cumulative Estimated Daily Intake (micrograms/kilogram body weight/person/day, µg/kg bw/d)
  • 21 CFR: The Code of Federal Regulations, Title 21 is the preferred reference to determine the regulatory status of Indirect Food Additives. Substances whose names appear in 21 CFR, parts 175-178 are authorized for specified intended users and conditions of use as stated in the regulation. Note that substances may appear in more than one regulation, or several times in the same regulation. Note that if a substance is mentioned in 21 CFR parts 175-178 and thus, is listed above, any other citations for the same substance in other sections of 21 CFR dealing with food additives (parts 1-199 inclusive) may also be cited.
-
-